Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1122427
End position: 1122471
Length: 45

DNA sequence
>NC_016804, from 1122427 to 1122471 (45 bp); Mycobacterium bovis BCG str. Mexico GCCGGGGATGCCGATGCCCGGGATGCCGATGCCCGGGATGCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1121657-1122916	Sequence	BCGMEX_1033c - hypothetical protein (Protein is coded in complementary strand; from 1122916 to 1121657)