Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1264425
End position: 1264469
Length: 45

DNA sequence
>NC_016804, from 1264425 to 1264469 (45 bp); Mycobacterium bovis BCG str. Mexico AAGGTGCCCGAGTTGAAGCTGCCCGTGTTGTAGGCACCCGAGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1263966-1265822	Sequence	BCGMEX_1168c PPE16 PPE family protein (Protein is coded in complementary strand; from 1265822 to 1263966)