Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1758764
End position: 1758808
Length: 45

DNA sequence
>NC_016804, from 1758764 to 1758808 (45 bp); Mycobacterium bovis BCG str. Mexico TGGACCGGCGCCTGTTGGACCGGCGCCTGTTGGACGGGCGCCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1758701-1759393	Sequence	BCGMEX_1591c - putative inv protein (Protein is coded in complementary strand; from 1759393 to 1758701)