Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2917494
End position: 2917538
Length: 45

DNA sequence
>NC_016804, from 2917494 to 2917538 (45 bp); Mycobacterium bovis BCG str. Mexico CCGGCGCCAACGCTGCCGGCGCAACCGATGCCGGCGCAACCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2916789-2917547	Sequence	BCGMEX_2673 clpX' putative ATP-dependent protease ATP-binding subunit