Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 374561
End position: 374605
Length: 45

DNA sequence
>NC_016804, from 374561 to 374605 (45 bp); Mycobacterium bovis BCG str. Mexico ATGCCGGTGTTGTAGTCGCCGGTGTTGAAGTAGCCGGTGTTGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 371045-376972	Sequence	BCGMEX_0315c PPE6 PPE family protein (Protein is coded in complementary strand; from 376972 to 371045)