Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 428470
End position: 428514
Length: 45

DNA sequence
>NC_016804, from 428470 to 428514 (45 bp); Mycobacterium bovis BCG str. Mexico ATTGCCGAGGTTTGCACTGCCGAGGTTTGCACTGCCGAGGTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 425303-435826	Sequence	BCGMEX_0363c PPE8 PPE family protein (Protein is coded in complementary strand; from 435826 to 425303)