Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 532684
End position: 532728
Length: 45

DNA sequence
>NC_016804, from 532684 to 532728 (45 bp); Mycobacterium bovis BCG str. Mexico TGCCGGTGTTGCCGGTGCCGATGTTGCCGGTGCCGGTGTTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 531900-533339	Sequence	BCGMEX_0452c PPE10 PPE family protein (Protein is coded in complementary strand; from 533339 to 531900)