Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 978190
End position: 978234
Length: 45

DNA sequence
>NC_016804, from 978190 to 978234 (45 bp); Mycobacterium bovis BCG str. Mexico GCATTGCCGATGTTGCCGTTGCCGAGGTTGGCGTTGCCGATATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 977611-978939	Sequence	BCGMEX_0901c PPE13 PPE family protein (Protein is coded in complementary strand; from 978939 to 977611)