Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 24674
End position: 24727
Length: 54

DNA sequence
>NC_016804, from 24674 to 24727 (54 bp); Mycobacterium bovis BCG str. Mexico GGTACCCGCGCTGGTCGGGGTAGCCGCGTTGCTCGGGGTAACCGCCCTGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 23860-25425	Sequence	BCGMEX_0020c - hypothetical protein (Protein is coded in complementary strand; from 25425 to 23860)