Sequence retrieval

Genome: Rickettsia rickettsii str. Hino
Start position: 109808
End position: 109831
Length: 24

DNA sequence
>NC_016914, from 109808 to 109831 (24 bp); Rickettsia rickettsii str. Hino GTGGCGGTGGTGGTGGTGGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 107533-113091	Sequence	RPJ_00650 - hypothetical protein (Protein is coded in complementary strand; from 113091 to 107533)