Sequence retrieval

Genome: Rickettsia rickettsii str. Hino
Start position: 659250
End position: 659273
Length: 24

DNA sequence
>NC_016914, from 659250 to 659273 (24 bp); Rickettsia rickettsii str. Hino AATGAAAATTAATATGAAAATGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 658841-659674	Sequence	RPJ_03750 - glutamine synthetase (Protein is coded in complementary strand; from 659674 to 658841)