Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1389414
End position: 1389437
Length: 24

DNA sequence
>NC_016940, from 1389414 to 1389437 (24 bp); Saprospira grandis str. Lewin ACCATCACCATCAGCATCACAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1389399-1389602	Sequence	SGRA_1368 - hypothetical protein (Protein is coded in complementary strand; from 1389602 to 1389399)