Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1434149
End position: 1434172
Length: 24

DNA sequence
>NC_016940, from 1434149 to 1434172 (24 bp); Saprospira grandis str. Lewin CCCTTCGGCCCTTTGGGCCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1434105-1434260	Sequence	SGRA_1407 - hypothetical protein (Protein is coded in complementary strand; from 1434260 to 1434105)