Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 159433
End position: 159456
Length: 24

DNA sequence
>NC_016940, from 159433 to 159456 (24 bp); Saprospira grandis str. Lewin AAAGTCAAAGGCAAAGTCAAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 159332-159967	Sequence	SGRA_0172 - hypothetical protein (Protein is coded in complementary strand; from 159967 to 159332)