Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1713913
End position: 1713948
Length: 36

DNA sequence
>NC_016940, from 1713913 to 1713948 (36 bp); Saprospira grandis str. Lewin AAAATATTTTTTAATATTTTTTTTGAATTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1713754-1714107	Sequence	SGRA_1688 - hypothetical protein (Protein is coded in complementary strand; from 1714107 to 1713754)