Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1812640
End position: 1812663
Length: 24

DNA sequence
>NC_016940, from 1812640 to 1812663 (24 bp); Saprospira grandis str. Lewin TGAGTTCGAGTTTGAGTTTGAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1812195-1812692	Sequence	SGRA_1786 - hypothetical protein (Protein is coded in complementary strand; from 1812692 to 1812195)