Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1943071
End position: 1943100
Length: 30

DNA sequence
>NC_016940, from 1943071 to 1943100 (30 bp); Saprospira grandis str. Lewin CAAAACCCGCCAAACGCCGCCAAAACGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1942617-1943639	Sequence	SGRA_1928 serA D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding protein (Protein is coded in complementary strand; from 1943639 to 1942617)