Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1949197
End position: 1949232
Length: 36

DNA sequence
>NC_016940, from 1949197 to 1949232 (36 bp); Saprospira grandis str. Lewin CTTTTACCAACCCTTTTACCAACCCTTTTACCAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1948989-1950329	Sequence	SGRA_1935 - LexA DNA-binding protein (Protein is coded in complementary strand; from 1950329 to 1948989)