Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 1967814
End position: 1967846
Length: 33

DNA sequence
>NC_016940, from 1967814 to 1967846 (33 bp); Saprospira grandis str. Lewin AAAATATTTTTAATATTTTTTTGAATTATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1967655-1967816	Sequence	SGRA_1952 - hypothetical protein (Protein is coded in complementary strand; from 1967816 to 1967655)
ORF... 1967824-1967958	Sequence	SGRA_1953 - hypothetical protein (Protein is coded in complementary strand; from 1967958 to 1967824)