Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 2146448
End position: 2146474
Length: 27

DNA sequence
>NC_016940, from 2146448 to 2146474 (27 bp); Saprospira grandis str. Lewin CCAAAAAGGCCACAAAGGGCAAAAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2145985-2146653	Sequence	SGRA_2133 - colicin V production protein (Protein is coded in complementary strand; from 2146653 to 2145985)