Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 3093646
End position: 3093670
Length: 25

DNA sequence
>NC_016940, from 3093646 to 3093670 (25 bp); Saprospira grandis str. Lewin AAAACAAAAGAAAGCAAAACAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3093093-3093686	Sequence	SGRA_3006 - hypothetical protein (Protein is coded in complementary strand; from 3093686 to 3093093)