Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 320904
End position: 320927
Length: 24

DNA sequence
>NC_016940, from 320904 to 320927 (24 bp); Saprospira grandis str. Lewin TCATCGTAATCGTCATCATCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 320784-321137	Sequence	SGRA_0331 - hypothetical protein (Protein is coded in complementary strand; from 321137 to 320784)