Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 426690
End position: 426713
Length: 24

DNA sequence
>NC_016940, from 426690 to 426713 (24 bp); Saprospira grandis str. Lewin GCCACCGCCACCGCCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 421819-427872	Sequence	SGRA_0445 - hypothetical protein (Protein is coded in complementary strand; from 427872 to 421819)