Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 60368
End position: 60430
Length: 63

DNA sequence
>NC_016940, from 60368 to 60430 (63 bp); Saprospira grandis str. Lewin CCAGACATCATTGACCATACCCCAGACATCATTGACCATACCCCAGACATCATTGACCATACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 60216-60428	Sequence	SGRA_0070 - hypothetical protein (Protein is coded in complementary strand; from 60428 to 60216)