Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 709814
End position: 709843
Length: 30

DNA sequence
>NC_016940, from 709814 to 709843 (30 bp); Saprospira grandis str. Lewin AGAGCAAAACAAAGCCAAACAGACCAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 709486-710295	Sequence	SGRA_0709 - hypothetical protein (Protein is coded in complementary strand; from 710295 to 709486)