Sequence retrieval

Genome: Saprospira grandis str. Lewin
Start position: 810424
End position: 810459
Length: 36

DNA sequence
>NC_016940, from 810424 to 810459 (36 bp); Saprospira grandis str. Lewin GATGATGCAGCAAATGATGCAACAGATGATGAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 809595-810650	Sequence	SGRA_0791 - putative virion core protein (lumpy skin disease virus)-like protein