Sequence retrieval

Genome: Rickettsia prowazekii str. Chernikova
Start position: 22887
End position: 22911
Length: 25

DNA sequence
>NC_017049, from 22887 to 22911 (25 bp); Rickettsia prowazekii str. Chernikova AAAATAAAAATAAATAAACTAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 22446-23174	Sequence	M9W_00105 - F0F1 ATP synthase subunit A (Protein is coded in complementary strand; from 23174 to 22446)