Sequence retrieval

Genome: Rickettsia prowazekii str. Chernikova
Start position: 796129
End position: 796155
Length: 27

DNA sequence
>NC_017049, from 796129 to 796155 (27 bp); Rickettsia prowazekii str. Chernikova CCACCCATGCCACCCATGCCGCCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 796117-797769	Sequence	M9W_03010 groEL chaperonin GroEL (Protein is coded in complementary strand; from 797769 to 796117)