Sequence retrieval

Genome: Rickettsia prowazekii str. RpGvF24
Start position: 190736
End position: 190759
Length: 24

DNA sequence
>NC_017057, from 190736 to 190759 (24 bp); Rickettsia prowazekii str. RpGvF24 CATCAACTTCAACATTAACATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 189685-191991	Sequence	MA7_00770 - outer membrane protein omp1 (Protein is coded in complementary strand; from 191991 to 189685)