Sequence retrieval

Genome: Rickettsia prowazekii str. RpGvF24
Start position: 22875
End position: 22899
Length: 25

DNA sequence
>NC_017057, from 22875 to 22899 (25 bp); Rickettsia prowazekii str. RpGvF24 AAAATAAAAATAAATAAACTAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 22434-23162	Sequence	MA7_00105 - F0F1 ATP synthase subunit A (Protein is coded in complementary strand; from 23162 to 22434)