Sequence retrieval

Genome: Rickettsia prowazekii str. RpGvF24
Start position: 798389
End position: 798415
Length: 27

DNA sequence
>NC_017057, from 798389 to 798415 (27 bp); Rickettsia prowazekii str. RpGvF24 CCACCCATGCCACCCATGCCGCCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 798377-800029	Sequence	MA7_03005 groEL chaperonin GroEL (Protein is coded in complementary strand; from 800029 to 798377)