Sequence retrieval

Genome: Acetobacter pasteurianus IFO 3283-26
Start position: 565344
End position: 565388
Length: 45

DNA sequence
>NC_017146, from 565344 to 565388 (45 bp); Acetobacter pasteurianus IFO 3283-26 GGTGCGGCGTATCCCGGTGCGGCATAACCGGGGGCAGCGTAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 565332-565877	Sequence	APA26_05490 - hypothetical protein (Protein is coded in complementary strand; from 565877 to 565332)