Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1126381
End position: 1126425
Length: 45

DNA sequence
>NC_017200, from 1126381 to 1126425 (45 bp); Bacillus thuringiensis serovar finitimus YBT-020 GGAAAAGCCACATGTGGAAAACCCAGAAGTGGAAAAGCCAGATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1126083-1126862	Sequence	YBT020_05455 - hypothetical protein