Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 904134
End position: 904187
Length: 54

DNA sequence
>NC_017200, from 904134 to 904187 (54 bp); Bacillus thuringiensis serovar finitimus YBT-020 TTAGCTTCTGCTTGAGCTTCAGCTGCTTCTTGAGCTTTAGCTTCTGCCTGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 903690-904832	Sequence	YBT020_04270 - hypothetical protein (Protein is coded in complementary strand; from 904832 to 903690)