Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1133632
End position: 1133664
Length: 33

DNA sequence
>NC_017200, from 1133632 to 1133664 (33 bp); Bacillus thuringiensis serovar finitimus YBT-020 TTGATAAAAAATAGATAAAAAGTTGATAAGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1133314-1133646	Sequence	YBT020_05525 - hypothetical protein