Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1144971
End position: 1144994
Length: 24

DNA sequence
>NC_017200, from 1144971 to 1144994 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 GGTGTTGCTGTTGGTGTAGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1144780-1148031	Sequence	YBT020_05620 - putative phage tail tape measure protein