Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1354241
End position: 1354267
Length: 27

DNA sequence
>NC_017200, from 1354241 to 1354267 (27 bp); Bacillus thuringiensis serovar finitimus YBT-020 TCCAGTCGGCCCAGTCGGTCCAGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1353661-1354404	Sequence	YBT020_06710 - hypothetical protein