Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1427088
End position: 1427132
Length: 45

DNA sequence
>NC_017200, from 1427088 to 1427132 (45 bp); Bacillus thuringiensis serovar finitimus YBT-020 TTCAGCAGGCTTTTGCTCAGCTGGTTTTTGTTCAGCCGGTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1426699-1427526	Sequence	YBT020_07125 - hypothetical protein (Protein is coded in complementary strand; from 1427526 to 1426699)