Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1569178
End position: 1569204
Length: 27

DNA sequence
>NC_017200, from 1569178 to 1569204 (27 bp); Bacillus thuringiensis serovar finitimus YBT-020 TCCAGTAGCACCAGTAGCGCCAGTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1568066-1569934	Sequence	YBT020_07930 - group-specific protein (Protein is coded in complementary strand; from 1569934 to 1568066)