Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 1739856
End position: 1739879
Length: 24

DNA sequence
>NC_017200, from 1739856 to 1739879 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 TAGTATTTTAGTATTTTAGTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1739182-1739859	Sequence	YBT020_08805 - flagellar motor protein MotS