Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 2233803
End position: 2233847
Length: 45

DNA sequence
>NC_017200, from 2233803 to 2233847 (45 bp); Bacillus thuringiensis serovar finitimus YBT-020 AACAGGAGGAACTGGAACAGGAGGAACTGGAACAGAAGGAACTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2233316-2236033	Sequence	YBT020_11300 - group-specific protein