Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 2233946
End position: 2233981
Length: 36

DNA sequence
>NC_017200, from 2233946 to 2233981 (36 bp); Bacillus thuringiensis serovar finitimus YBT-020 AACCAAAACCAGAACCAAAACCAGAACCAAAACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2233316-2236033	Sequence	YBT020_11300 - group-specific protein