Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 3043165
End position: 3043188
Length: 24

DNA sequence
>NC_017200, from 3043165 to 3043188 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 TTTTTTTATATTTTTATTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3042866-3043534	Sequence	YBT020_15630 - hypothetical protein (Protein is coded in complementary strand; from 3043534 to 3042866)