Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 3096803
End position: 3096832
Length: 30

DNA sequence
>NC_017200, from 3096803 to 3096832 (30 bp); Bacillus thuringiensis serovar finitimus YBT-020 CAATATACATCAATATCCAACCAAATACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3096664-3097944	Sequence	YBT020_15860 - hypothetical protein (Protein is coded in complementary strand; from 3097944 to 3096664)