Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 3226518
End position: 3226544
Length: 27

DNA sequence
>NC_017200, from 3226518 to 3226544 (27 bp); Bacillus thuringiensis serovar finitimus YBT-020 GCTCCTGTTGCTCCGGTTGCTCCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3225786-3228293	Sequence	YBT020_16540 - Collagen-like triple helix repeat protein (Protein is coded in complementary strand; from 3228293 to 3225786)