Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 3698533
End position: 3698556
Length: 24

DNA sequence
>NC_017200, from 3698533 to 3698556 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 CAATTCCAACTCCAATTGCAATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3698163-3698936	Sequence	YBT020_18830 rnhB ribonuclease HII (Protein is coded in complementary strand; from 3698936 to 3698163)