Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 3831535
End position: 3831558
Length: 24

DNA sequence
>NC_017200, from 3831535 to 3831558 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 CAAGTGCAAGTCCAACTGCAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3830775-3831752	Sequence	YBT020_19520 - pyruvate dehydrogenase complex E1 component subunit beta (Protein is coded in complementary strand; from 3831752 to 3830775)