Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 3980974
End position: 3981009
Length: 36

DNA sequence
>NC_017200, from 3980974 to 3981009 (36 bp); Bacillus thuringiensis serovar finitimus YBT-020 TGCTCTGCAACTTGCATTGCAACTTGCTCTCCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3980269-3981063	Sequence	YBT020_20365 - oxidoreductase, short-chain dehydrogenase/reductase family protein (Protein is coded in complementary strand; from 3981063 to 3980269)