Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4245218
End position: 4245241
Length: 24

DNA sequence
>NC_017200, from 4245218 to 4245241 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 CTTCTTCTTCATCCTCTTCTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4245214-4248096	Sequence	YBT020_21815 - spoVID-dependent spore coat assembly factor; FtsK/SpoIIIE family protein; surface protein (Protein is coded in complementary strand; from 4248096 to 4245214)