Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4280964
End position: 4281008
Length: 45

DNA sequence
>NC_017200, from 4280964 to 4281008 (45 bp); Bacillus thuringiensis serovar finitimus YBT-020 TCTTCTATTTCCTCTTCTTCTACTTCCTGCTCTTTTCTTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4280610-4281587	Sequence	YBT020_21975 - stage VI sporulation protein D (Protein is coded in complementary strand; from 4281587 to 4280610)